 Recently visited | Recently updated |
 BETA |
About
Articles
Classification
Search
Authors
Feedback
Citation
API RARB  retinoic acid receptor, beta |
| ||||||||||
The article completion score for this TF is 89%. Refresh score »
Download scoring guide and see what's missing »
The article completion score is designed to help authors identify parts of their articles that can be expanded upon. We highly recommend completing the following steps to significantly increase this article's score:
Please provide more information in the Overview section of the Targets tab.
Please provide more information in the Genetics section of the Genetics tab.
If applicable, please provide more information in the Isoforms section of the Protein tab.
Please provide more information in the Overview section of the Expression tab.
Please provide more information in the Covalent modifications section of the Protein tab.
Please provide more information in the Overview section of the Interactions tab.
Download article
Download data
View recent activityComments (post)
There are no comments posted here... Yet.
TFBS logos
Overview
RAR/RXR heterodimers bind RAREs, which are composed of direct repeats (DR) of the motif PuG(G/T)TCA, classically separated by 2 or 5 bp.[1] DR1 RAREs can also be bound by RAR/RXR heterodimers, but with an opposite polarity of the RAR and RXR monomers.[2] Everted repeats with 8 bp spacing have also been shown to function as RAREs.[3][4] Proximal promoters of several RAR target genes contain highly conserved RAREs (e.g. CYP26A1 and HOX genes). In addition, sites located at much greater distances (several kbp or tens of kbp from the transcriptional start site) can function as transcriptional enhancers.[5] Genome-wide chromatin binding sites of RARs have been characterized by chromatin immunoprecipitation assays in the MCF7 human breast cancer cell line and revealed extensive overlap with regions bound by estrogen receptor alpha, suggesting cross-talk between the transcriptional networks of these two families of nuclear receptors.[6][7]
References
- Mader S et al. The patterns of binding of RAR, RXR and TR homo- and heterodimers to direct repeats are dictated by the binding specificites of the DNA binding domains. EMBO J., 12(13):5029-41. (PMID 8262045)
- Zechel C et al. The dimerization interfaces formed between the DNA binding domains of RXR, RAR and TR determine the binding specificity and polarity of the full-length receptors to direct repeats. EMBO J., 13(6):1425-33. (PMID 8137826)
- Tini M et al. An everted repeat mediates retinoic acid induction of the gamma F-crystallin gene: evidence of a direct role for retinoids in lens development. Genes Dev., 7(2):295-307. (PMID 8436299)
- Tavera-Mendoza L et al. Convergence of vitamin D and retinoic acid signalling at a common hormone response element. EMBO Rep., 7(2):180-5. (PMID 16322758)
- Balmer JE and Blomhoff R. A robust characterization of retinoic acid response elements based on a comparison of sites in three species. J. Steroid Biochem. Mol. Biol., 96(5):347-54. (PMID 16081280)
- Hua S et al. Genomic antagonism between retinoic acid and estrogen signaling in breast cancer. Cell, 137(7):1259-71. (PMID 19563758)
- Ross-Innes CS et al. Cooperative interaction between retinoic acid receptor-alpha and estrogen receptor in breast cancer. Genes Dev., 24(2):171-82. (PMID 20080953)
Binding site profiles
About this section
These binding site profiles were generated dynamically using the MEME pattern discovery algorithm with data found in the PAZAR Database, linked by various Ensembl Gene IDs. Multiple binding site profiles result from different datasets for the same transcription factor or from the same transcription factor from different species and are identified by different PAZAR TF IDs. PAZAR (http://www.pazar.info/) is a public database of transcription factor and regulatory sequence annotation.
There are no sites in this dataset.
| Sequence | Gene | TF or TF complex | Pazar sequence | |
| 1 | AGGTCAAAAGGTCA 14 |
RBP1 (mouse) | RAR_HUMAN, RXR/RAR_MOUSE | RS0145808 |
| Sequence | Gene | TF or TF complex | Pazar sequence | |
| 1 | AGGGTTCACCGAAAGTTCACTCGC 24 |
GS0000897 (human) | RARA_HUMAN | RS0001572 |
There are no sites in this dataset.
| Sequence | Gene | TF or TF complex | Pazar sequence | |
| 1 | GTTCAC 6 |
RARB (mouse) | RARB_MOUSE | RS0002018 |
| 2 | GTTCAC 6 |
RARB (mouse) | RARB_MOUSE | RS0002019 |
| Sequence | Gene | TF or TF complex | Pazar sequence | |
| 1 | GGTTCACCGAAAGTTCA 17 |
RARB (human) | RARB_HUMAN, RXR/RAR_HUMAN | RS0145801 |
| Sequence | Gene | TF or TF complex | Pazar sequence | |
| 1 | AGAGGATGAGGTCATTGGCCT 21 |
NES (human) | NR2F1 (COUP-TF)_HUMAN, RXRA_HUMAN, RXR/RAR_HUMAN | RS0000993 |
Links
51 well-documented, conserved retinoic acid response elements (new window)Characterization of retinoic acid response elements based on a comparison of sites in three species. J.E. Balmer and R. Blomhoff 2005.
